Journal of the American Chemical Society, Vol.120, No.48, 12395-12401, 1998
Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection
A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in >95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5)'GTCACGACGTTGTAAAACGAC(3)' (21mer), (5)'CAGGAAACAG-CTATGACCATG(3)' (21mer), (5)'CAAGTTGATGAACAATACTTCATACCTAAACT(3)' (32mer), and 5'TATGGGCCTTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTTATT(3)' (60mer),which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.
Keywords:DEOXYNUCLEOSIDE PHOSPHORAMIDITES;CHEMICAL SYNTHESIS;DNA-SYNTHESIS;OLIGONUCLEOTIDE SYNTHESIS;NUCLEOTIDE CHEMISTRY;DEPROTECTION;DEOXYOLIGONUCLEOTIDES;OLIGOMERS;REAGENTS