Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 degrees C was approximately 80 folds lower than that at 25 degrees C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 degrees C to 25 degrees C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. (C) 2016 Elsevier Inc. All rights reserved.